Academic
Publications
Increased Platelet Aggregability Associated With Platelet GPIIIa PlA2 Polymorphism The Framingham Offspring Study

Increased Platelet Aggregability Associated With Platelet GPIIIa PlA2 Polymorphism The Framingham Offspring Study,Klaus Lindpaintner,Martin G. Larson,

Increased Platelet Aggregability Associated With Platelet GPIIIa PlA2 Polymorphism The Framingham Offspring Study   (Citations: 76)
BibTex | RIS | RefWorks Download
The platelet glycoprotein IIb/IIIa (GP IIb/IIIa) plays a pivotal role in platelet aggregation. Recent data suggest that the PlA2 polymorphism of GPIIIa may be associated with an increased risk for cardiovascular disease. However, it is unknown if there is any association between this polymorphism and platelet reactivity. We determined GP IIIa genotype and platelet reactivity phenotype data in 1422 subjects from the Framingham Offspring Study. Genotyping was performed using PCR-based restriction fragment length polymorphism analysis. Platelet aggregability was evaluated by the Born method. The threshold concentrations of epinephrine and ADP were determined. Allele frequencies of PlA1 and PlA2 were 0.84 and 0.16, respectively. The presence of 1 or 2 PlA2 alleles was associated with increased platelet aggregability as indicated by incrementally lower threshold concentrations for epinephrine and ADP. For epinephrine, the mean concentrations were 0.9 mmol/L (0.9 to 1.0) for homozygous PlA1, 0.7 mmol/L (0.7 to 0.9) for the heterozygous PlA1/PlA2, and 0.6 mmol/L (0.4 to 1.0) for homozygous PlA2 individuals, P50.009. The increase in aggregability induced by epinephrine remained highly significant (P50.007) after adjustment for covariates. For ADP-induced aggregation, the respective mean concentrations were 3.1 mmol/L (3.0 to 3.2), 3.0 mmol/L (2.9 to 3.2), and 2.8 mmol/L (2.4 to 3.3); P50.19 after adjustment for covariates. Our findings indicate that molecular variants of the gene encoding GP IIIa play a role in platelet reactivity in vitro. Our observations are compatible with and provide an explanation for the reported association of the PlA2 allotype with increased risk for cardiovascular disease. (Arterioscler Thromb Vasc Biol. 1999;19:1142-1147.)
Published in 2010.
Cumulative Annual
View Publication
The following links allow you to view full publications. These links are maintained by other sources not affiliated with Microsoft Academic Search.
    • ...In vitro studies have also shown that significantly less epinephrine (minimal threshold concentration) was required to induce platelet aggregation in the carrier than in non-carriers, and this effect was dose dependent [25]...

    Arijit Biswaset al. Prothrombotic polymorphisms, mutations, and their association with ped...

    • ...The PlA1/PlA2 polymorphism is characterized by enhanced affinity of the receptor for fibrinogen and increases platelet aggregability [15]...
    • ...platelet aggregability. In vitro studies showed about a 19% lower epinephrine threshold concentration for activation of platelets with PlA2 [15]...
    • ...Increased platelet aggregation could result in thrombosis as was shown for arterial events [15], In our study PlA2 was found in 35.3% of the patients versus 14.3% of the control group with an OR value comparable to that of thrombophilic mutations FVL and FII G20210A (Table 2). These results support the idea about the contribution of PlA2 carriage to PE development...

    Petar Ivanovet al. Impact of Thrombophilic Genetic Factors on Pulmonary Embolism: Early O...

    • ...The A1/A2 GPIIIa polymorphism [4] can influence both platelet activation and aggregation [5-7] and affects post occupancy signalling by the platelet fibrinogen receptor IIb/IIIa [8]...
    • ...Although the Framingham Offspring Study showed heightened platelet aggregability among patients with PlA2 allele [5], the clinical impact of this polymorphism remains unclear despite many casecontrol studies [10-15], many observational studies [16- 22] and 3 meta-analyses [23-25]...

    Claire Le Helloet al. Effect of PlA1/A2 glycoprotein IIIa gene polymorphism on the long-term...

    • ...In fact, such epistasis may be mediated by estrogen, which can both suppress ITGB3 mRNA levels (Kimmins et al. 2003) and lower circulating levels of Lp(a) (Espeland et al. 1998; Farish et al. 1996)...

    Lauren A. Weisset al. Variation in ITGB3 has sex-specific associations with plasma lipoprote...

    • ...In the present study we evaluated the impact of integrin β3 gene Leu33/Pro33 polymorphism on the three most common forms of primary glomerulonephritis: IgA nephropathy (IgAN), focal segmental glomerulosclerosis (FSGS) and membranous glomerulonephritis (MGN).Patients and MethodsPatients and ControlsWe studied 251 Caucasian patients (168 males, 83 females) with biopsy-proven primary glomerulonephritis (IgA n = 127, FSGS n = 71, MGN n = 53) treated at our center from 1968 to 2003. The mean follow-up period was 6.3 ± 5.3 years and included monitoring of serum creatinine, endogenous creatinine clearance (24-hour urine collection), proteinuria, blood pressure and antihypertensive medication. Arterial hypertension was defined by the presence of blood pressure values ≥140 mm Hg systolic and/or ≥90 mm Hg diastolic or the need for antihypertensive treatment. A mean of 21.6 ± 19 data points were retrieved. Only patients followed up for at least 1 year were included. One hundred age-matched volunteers (44 males and 56 females) without history of kidney diseases or arterial hypertension served as a control group. The present study was approved by the local ethics committee.Determination of Integrin β3 Gene Leu33/Pro33 PolymorphismGenomic DNA was extracted from peripheral leukocytes from whole blood samples using the QIAmp DNA BloodMini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. A polymerase chain reaction (PCR) amplification with the following primers was carried out: sense: 5′ CTTAGCTATTGGGAAGTGGTAGG 3′, antisense: 5′ ACTGACTTGAGTGACCTGG GAG 3′ (MWG Biotech AG, Ebersberg, Germany). After restriction digestion with the endonuclease Bcnl (MBI Fermentas GmbH, St. Leon-Rot, Germany) the initial 256-bp PCR product was cut into two fragments (154 and 102 bp) in the presence of Pro33 allele.Statistical AnalysisData were expressed as percentages or means ± SD. Pearson’s χ2 was used for categorical data. Differences in continuous variables were tested with the Student’s t test or the non-parametric Mann-Whitney U test. The individual rate of progression of renal insufficiency was calculated as the slope of reciprocal serum creatinine versus time plot (linear regression). The Kaplan-Meier method using a log rank test was employed for survival analysis of the kidney as a functioning organ. The endpoints included ESRD or doubling of the initial serum creatinine. A Cox regression model was used for multivariate analysis. The following covariates were tested: sex, age, serum creatinine, proteinuria and blood pressure at the time of renal biopsy and integrin β3 gene Leu33/Pro33 polymorphism. Statistical analysis was performed using the SPSS 10.0 program (Statistical Package for Social Sciences, SSPS GmbH, Munich, Germany). All tests were two-sided and statistical significance was defined as p < 0.05.ResultsPatients’ CharacteristicsThe present study included 251 patients (168 males, 83 females) with biopsy-proven primary glomerulonephritis (IgAN n = 127, FSGS n = 71, MGN n = 53). Initial clinical and laboratory findings, antihypertensive medication and immunosuppression are summarized for each disease entity in table 1. The slope of reciprocal serum creatinine (1/Cr) against time was used to evaluate the individual rate of progression. Its mean value was –0.152 ± 0.389 mg–1·dl·year–1 [–1.8·10–3 ± 4.7·10–3 μmol–1·l·year–1, representing a rise in serum creatinine from 1.0 to 2.0 mg/dl (88.4–176.8 μmol/l) over a 3-year period]. Patients were classified accordingly into group A [≥–0.1 mg–1·dl·year–1 (≥–1.2·10–3 μmol–1·l·year–1), slow progressors, IgAN n = 78, FSGS n = 49, MGN n = 35] and group B [<–0.1 mg–1·dl·year–1 (<–1.2·10–3 μmol–1·l·year–1), fast progressors, IgAN n = 49, FSGS: n = 22, MGN n = 18]. By the time of genotyping, 124 patients (49.4%) had a preserved renal function, while 127 patients (50.6%) had reached ESRD. As far as non-genetic factors were concerned, renal function at renal biopsy (Cox regression: IgAN and FSGS p < 0.001, MGN p < 0.01), the amount of proteinuria (IgAN p < 0.001) and blood pressure values (IgAN and FSGS p < 0.01) but not gender or age (n.s.) were associated with progression. Patients with IgAN receiving ACE inhibitors tended to have a better outcome (p = 0.06).1Table 1. Clinical and laboratory parameters at the time of renal biopsy (mean ± SD) and treatment in 251 patients with biopsy-proven primary glomerulonephritisT01
      β3 Integrin Genotyping and Parameters at the Time of Renal BiopsyNo significant difference was found in the genotype frequencies between the control group and IgAN, FSGS and MGN subpopulations or the complete patient cohort (n.s., table 2). The observed genotype frequencies corresponded in all groups to the expected values according to the Hardy-Weinberg equilibrium. There were no relevant differences between patients with different β3 integrin genotypes at the time of renal biopsy in terms of age, renal function, proteinuria and blood pressure (n.s.).2Table 2. Genotype frequencies of β3 integrin gene Leu33/Pro33 polymorphism in 100 control subjects and in 251 patients with biopsy-proven primary glomerulonephritisT02
      Impact of β3 Integrin Genotype on Progressionβ3 integrin gene polymorphism did not influence the progression of primary glomerulonephritis. The genotype frequencies were similar in group A (slow progressors) and group B (fast progressors) as well in the complete cohort as in the subgroups studied (n.s., table 3). Furthermore, no significant difference was observed between patients with different β3 integrin genotypes in the Kaplan-Meier analysis of renal survival in the whole study population or in the individual disease entities (n.s.). Similarly, β3 integrin gene polymorphism was not detected as an independent risk factor of progression in the multivariate analysis (Cox regression model, n.s.).3Table 3. Genotype frequencies of μ�3 integrin gene Leu33/Pro33 polymorphism in group A (slow progressors) and group B (fast progressors) in 251 patients with biopsy-proven primary glomerulonephritisT03
      DiscussionIn view of the role that both platelets and integrin-mediated cell-matrix interactions are thought to play in the development of renal injury, we assessed the effect of a genetic variant of β3 integrin gene, expressed on platelets as αIIbβ3 and on a variety of renal cells as αvβ3 integrinon primary glomerulonephritis. We were unable to detect any influence on the incidence, clinical manifestations and progression of IgAN, FSGS or MGN.Leu33/Pro33 polymorphism is thought to result in significant conformational changes in the structure of αIIbβ3 integrin and an increasing body of data concerning its impact on platelet function is becoming available. Increased platelet aggregability [...

    Christos Bantiset al. Influence of β3 Integrin Gene Leu33/Pro33 Polymorphism on Primary Glom...

Sort by: