Academic
Publications
The structure of a human neurofilament gene (NF-L): A unique exon-intron organization in the intermediate filament gene family

The structure of a human neurofilament gene (NF-L): A unique exon-intron organization in the intermediate filament gene family,10.1016/0167-4781(87)90

The structure of a human neurofilament gene (NF-L): A unique exon-intron organization in the intermediate filament gene family   (Citations: 22)
BibTex | RIS | RefWorks Download
We have cloned and determined the nucleotide sequence of the human gene for the neurofilament subunit NF-L. The cloned DNA contains the entire transcriptional unit and generates two mRNAs of approx. 2.6 and 4.3 kb after transfection into mouse L-cells. The NF-L gene has an unexpected intron-exon organization in that it entirely lacks introns at positions found in other members of the intermediate filament gene family. It contains only three introns that do not define protein domains. We discuss possible evolutionary schemes that could explain these results.
Journal: Biochimica Et Biophysica Acta-general Subjects - BBA-GEN SUBJECTS , vol. 909, no. 1, pp. 10-20, 1987
Cumulative Annual
View Publication
The following links allow you to view full publications. These links are maintained by other sources not affiliated with Microsoft Academic Search.
    • ...NFH-s2 Neurofilament Sense 484 bp ca 4500 bp 5′ctgctcaatgtcaagatggc 3′ Lees et al. (1988) NFH-a2 Heavy Antisense 5′ttctcaggggacttgacttc 3′ NFM-s2 Neurofilament Sense 309 bp 1640 bp 5′tcgtcatttgcgcgaatacc 3′ Myers et al. (1987) NFM-a2 Middle Antisense 5′gccaattcctctgtaatggc 3′ NFL-s2 Neurofilament Sense 537 bp 1057 bp 5′agtggaggaaaccattgagg 3′ Julien et al. (1987) NFL-a1 Light Antisense 5′ttgccgtagatcctgaactc 3′...

    M. S. Davidoffet al. Sertoli and Leydig cells of the human testis express neurofilament tri...

    • ...The nucleotide sequences of the NF-L cDNAs (2.1 kb) isolated from the wild-type and Quv quails are shown with their deduced amino acid sequences in Fig. 4. The wild-type quail NF-L eDNA was found to encode a protein composed of 556 amino acid residues, which is highly homologous to the other vertebrate NF-L proteins (Lewis and Cowan, 1986; Julien et al., 1987; Charnas et al., 1992)...
    • ...On the other hand, it is interesting to note that the nucleotide sequences in the proximal Y-flanking and untranslated regions of this gene have low homology to those of the mouse and human genes although these regions are well conserved between mouse and human (Lewis and Cowan, 1986; Julien et al., 1987; Beaudet et al., 1992)...

    Osamu Oharaet al. Neurofilament Deficiency in Quaff Caused by Nonsense Mutation in Neuro...

    • ...the single copy HNF-L gene on chromosome 8 (26) and the HNF-H (heavy chain) gene on chromosomes 1 and 22 (27)...

    W. J. Lukiwet al. BC200 RNA in normal human neocortex, non-Alzheimer dementia (NAD), and...

    • ...Such interactions are thought to contribute to the formation of oligomers and to interactions with other axonal proteins in neurofilaments (Julien et al., 1987)...

    Franco Widmeret al. Identification, localization, and primary structure of CAP23, a partic...

Sort by: